FASTQ (.fastq) File Format
FASTQ file format
Description
Details on the FASTQ format
Notes
Examples
References
FASTQ is a plaintext format for storing biological sequences and associated quality scores. It is similar to the FASTA format but in addition to sequence data it includes a quality score for each sequence element.
The commands Import and Export support this format.
Import produces an n×3 Matrix. Each row corresponds with a sequence element in the file:
the first column contains a sequence descriptor
the second column contains the sequence itself
the third column contains quality information
The FASTQ format employs the following standard IUB/IUPAC conventions for encoding protein or nucleic acid sequences as alphabetic characters. For details on this encoding, consult the FASTA format.
The quality string assigns a quality score to each element of the sequence. Each score is encoded as a single ASCII character with a mapping defined by the FASTQ specification.
Content-Type: chemical/seq-na-fastq
Import a DNA sequence from a FASTQ file.
Import⁡example/sample.fastq,base=datadir
Sequence1AACAGGGTTTGTTAAGATGGCAGAG;;7;<=>=<;;;;:979:;;;;988Sequence2CAATACACTGAAAATGTCGATGGAT;;;;;;<=>?@A?><;;;:-;3;83Sequence3CATACACAAACGCCTGAGCCTAGCA9393393;7;;;;;:::;;;:;;;9
Cock PJA, Fields CJ, Goto N, Heuer M, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research (2010) 38(6): 1767-1771, doi:10.1093/nar/gkp1137.
See Also
Formats
Formats,FASTA
Formats,GenBank
Download Help Document